Ref: Xie,J. unpublished

REBASE ref # 33196

Complete sequence: 4,008,714 bp

GenBank #: CP143956

REBASE acronym: Bam108

Org_num: 75269

 

All begin VXF94_

Type II
ORF Gene Most similar Specificity Name
 
7755 107 aa hypothetical protein
7760 M M.BveZY1ORF13730P (100% identity) M.Bam108ORF7760P
7765 84 aa hypothetical protein
 
14575 85 aa hypothetical protein
14580 M M.BveC1ORFAP (92% identity) M.Bam108ORF14580P
14585 107 aa hypothetical protein
 
15190 YusU family protein
15195 M M.Bsu13952ORF16390P (100% identity) GGATCC M.Bam108ORF15195P
15200 C C.Bsu13952ORF16390P (100% identity) ACTTATAGTCTGTAGCCTATAGTC C.Bam108ORF15195P
15205 R Bsu13952ORF16390P (100% identity) GGATCC Bam108ORF15195P
15210 MDR family MFS transporter
Tech Support Feedback NEB Overview Site Map Trademarks Legal and Disclaimers Privacy Cookie Policy Terms of Use
© Copyright 2023 New England Biolabs. All Rights Reserved.