Ref: Yang,H.-G. et al. unpublished

REBASE ref # 35217

Complete sequence: 4,176,994 bp

GenBank #: CP128501

REBASE acronym: Bam6

Org_num: 68836

 

All begin QTN46_

Type II
ORF Gene Most similar Specificity Name
 
2520 85 aa hypothetical protein
2525 M M.BveZY1ORF13730P (99% identity) M.Bam6ORF2525P
2530 107 aa hypothetical protein
 
9350 5-3-deoxyribonucleotidase
9355 M M.BcoB425ORF1800P (100% identity) CAGCTG M.Bam6ORF9355P
9360 DNA (cytosine-5-)-methyltransferase
 
9355 site-specific DNA-methyltransferase
9360 M M.Bsu13952ORF10440P (99% identity) GGCC M.Bam6ORF9360P
9365 72 aa hypothetical protein
 
13770 107 aa hypothetical protein
13775 M M.BveZY1ORF13730P (100% identity) M.Bam6ORF13775P
13780 84 aa hypothetical protein
 
14700 107 aa hypothetical protein
14705 M M.Bve9912DORF3190P (100% identity) M.Bam6ORF14705P
14710 84 aa hypothetical protein
 
17390 MDR family MFS transporter
17395 R Bsu13952ORF16390P (96% identity) GGATCC Bam6ORF17405P
17400 C C.Bsu13952ORF16390P (100% identity) ACTTATAGTCTGTAGCCTATAGTC C.Bam6ORF17405P
17405 M M.Bsu13952ORF16390P (100% identity) GGATCC M.Bam6ORF17405P
17410 YusU family protein
 
17975 107 aa hypothetical protein
17980 M M.BveZY1ORF13730P (100% identity) M.Bam6ORF17980P
17985 85 aa hypothetical protein
Tech Support Feedback NEB Overview Site Map Trademarks Legal and Disclaimers Privacy Cookie Policy Terms of Use
© Copyright 2023 New England Biolabs. All Rights Reserved.