Ref: Yang,H.-G. et al. unpublished

REBASE ref # 35216

Complete sequence: 3,832,374 bp

GenBank #: CP128500

REBASE acronym: Bam4

Org_num: 68835

 

All begin QTN45_

Type II
ORF Gene Most similar Specificity Name
 
905 ATP-binding protein
910 M M.Bsu13952ORF19190P (99% identity) GCWGC M.Bam4ORF910P
915 V V.Bsu13952ORF19190P (100% identity) V.Bam4ORF910P
920 beta-glucoside-specific PTS transporter subunit
 
4055 YusU family protein
4060 M M.Bsu13952ORF16390P (100% identity) GGATCC M.Bam4ORF4060P
4065 C C.Bsu13952ORF16390P (100% identity) ACTTATAGTCTGTAGCCTATAGTC C.Bam4ORF4060P
4070 R Bsu13952ORF16390P (100% identity) GGATCC Bam4ORF4060P
4075 MDR family MFS transporter
 
10720 67 aa hypothetical protein
10725 M M.BamLL3ORF3374P (100% identity) M.Bam4ORF10725P
10730 DNA polymerase
Tech Support Feedback NEB Overview Site Map Trademarks Legal and Disclaimers Privacy Cookie Policy Terms of Use
© Copyright 2023 New England Biolabs. All Rights Reserved.