REBASE Home

Bacillus amyloliquefaciens SRCM124317

[index] - [schematics] - [save as Word doc]
 REBASE Genomes

Putative Bacillus amyloliquefaciens SRCM124317 RM systems

Ref: Yang,H.-G. et al. unpublished

REBASE ref # 35217

Complete sequence: 3,902,592 bp

GenBank #: CP116011

REBASE acronym: Bam24317

Org_num: 64461

 

All begin PF976_

Type II
ORF Gene Most similar Specificity Name
 
2915 84 aa hypothetical protein
2920 M M.Bve9912DORF3190P (100% identity) M.Bam24317ORF2920P
2925 107 aa hypothetical protein
 
9135 115 aa hypothetical protein
9140 M M.BcoB425ORF1800P (100% identity) CAGCTG M.Bam24317ORF9140P
9145 DNA (cytosine-5-)-methyltransferase
 
9140 site-specific DNA-methyltransferase
9145 M M1.BsuH1716ORF11275P (99% identity) GGCC M.Bam24317ORF9145P
9150 72 aa hypothetical protein
 
15975 MDR family MFS transporter
15980 R Bsu13952ORF16390P (100% identity) GGATCC Bam24317ORF15990P
15985 C C.Bsu13952ORF16390P (100% identity) ACTTATAGTCTGTAGCCTATAGTC C.Bam24317ORF15990P
15990 M M.Bsu13952ORF16390P (100% identity) GGATCC M.Bam24317ORF15990P
15995 YusU family protein
Tech Support Feedback NEB Overview Site Map Trademarks Legal and Disclaimers Privacy Cookie Policy Terms of Use
© Copyright 2023 New England Biolabs. All Rights Reserved.