Ref: Fomenkov,A. et al. unpublished

REBASE ref # 30164

Complete sequence: 4,573,207 bp

GenBank #: CP050994

REBASE acronym: Ahd

Org_num: 107

 

All begin HFP99_

Type I
ORF Gene Most similar Specificity Name
 
4790 136 aa hypothetical protein
4795 M M.AveVA60ORF19680P (97% identity) GAAGNNNNNCTAY M.AhdIV
4800 S S.SspS13ORF2650P (46% identity) GAAGNNNNNCTAY S.AhdIV
4805 DUF262 domain-containing protein
4810 DUF262 domain-containing protein
4815 52 aa hypothetical protein
4820 DUF4011 domain-containing protein
4825 R Asp1415ORF15020P (98% identity) GAAGNNNNNCTAY AhdIVP
4830 M48 family metallopeptidase
 
18825 restriction endonuclease
18830 M M.CmeDORF110500P (87% identity) CTAYNNNNGTA M.AhdII
18835 S S.DdaXJ12ORFDP (53% identity) CTAYNNNNGTA S.AhdII
18840 338 aa hypothetical protein
18845 abortive phage resistance protein
18850 R CmeDORF110500P (96% identity) CTAYNNNNGTA AhdIIP
18855 DUF469 family protein
Type II
ORF Gene Most similar Specificity Name
 
1700 cell division protein DamX
1705 M M.Ari11N1Dam (99% identity) GATC M.AhdDam
1710 ribulose-phosphate 3-epimerase
 
3715 transcriptional regulator
3720 M M.CmeDORF249230P (92% identity) GCCGGC M.AhdIII
3725 R CmeDORF249230P (91% identity) GCCGGC AhdIIIP
3730 secretion activator protein
 
10565 C C.Dco806ORF34160P (56% identity) ACTCATAGTCCGTGGACTTATCGA C.AhdI
10570 R M.Mtu3132ORFDP (2% identity) GACNNNNNGTC AhdI
10575 S S.PmeK22ORF696P (23% identity) GACNNNNNGTC S.AhdI
10580 M M.AseS633ORFCP (26% identity) GACNNNNNGTC M.AhdI
10585 GNAT family N-acetyltransferase
Type IV
ORF Gene Most similar Specificity Name
 
18820 148 aa hypothetical protein
18825 R AhyYL17MrrP (96% identity) AhdMrrP
18830 type I restriction-modification system subunit
Tech Support Feedback NEB Overview Site Map Trademarks Legal and Disclaimers Privacy Cookie Policy Terms of Use
© Copyright 2023 New England Biolabs. All Rights Reserved.